
Protective equipment and health education program could benefit students from dust pollution

Protecting gear and well being training program may benefit college students from mud air pollution


Lately, youngsters dwelling within the downstream of the Choshui River in Taiwan have been uncovered to violent mud episodes. For the sake of the well being of those youngsters, we aimed to analyze the effectiveness of protecting gear (sand-proof plastic cowl and air air purifier) put in exterior/inside the school rooms on college students’ pulmonary operate and consider the well being training program for stopping the adversarial penalties of publicity to river-dust episodes. Public elementary faculty college students in Yunlin

County, which was severely affected by river-dust, had been chosen because the individuals. Research 1 consisted of three-wave follow-up information (801 person-times) in high-/low-dust publicity areas to look at pulmonary operate. Research 2 used 147 and 73 college students within the high-/low-dust publicity areas, respectively, to determine our well being training intervention. Paired t assessments, repeated measures ANOVA, and generalized estimating equation had been used to investigate the short- and long-term results.

The outcomes confirmed that the scholars’ pulmonary operate in colleges that put in protecting gear was improved. The well being training (such because the utilization of right masks and our designed PM2.5 full-cover sand-proof clothes) improved the scholars’ cognition and behaviors associated to river-dust episodes and yielded each short- and long-term results.

Subsequently, we recommend extra colleges with high-dust publicity to undertake protecting gear and well being training program. Our designed PM2.5 full-cowl sand-proof clothes can stop from not solely haze but additionally droplet transmission by infectious ailments reminiscent of COVID-19.

Utilizing Massive-Scale Additive Manufacturing as a Bridge Manufacturing Course of in Response to Shortages in Private Protecting Gear through the COVID-19 Outbreak


The worldwide coronavirus illness (COVID)-19 pandemic has led to a global scarcity of non-public protecting gear (PPE), with conventional provide chains unable to deal with the numerous demand resulting in crucial shortfalls. A lot of open and crowdsourcing initiatives have sought to deal with this shortfall by producing gear reminiscent of protecting face shields utilizing additive manufacturing strategies reminiscent of fused filament fabrication (FFF). This paper studies the method of designing and manufacturing protecting face shields utilizing large-scale additive manufacturing (LSAM) to supply the main thermoplastic elements of the face defend.
LSAM gives vital benefits over different additive manufacturing applied sciences in bridge manufacturing situations as a real transition between prototypes and mass manufacturing strategies reminiscent of injection molding.
Within the context of manufacturing of COVID-19 face shields, the power to supply the optimized elements in below 5 min in comparison with what would sometimes take 1 – 2 h utilizing one other additive manufacturing applied sciences meant that vital manufacturing quantity could possibly be achieved quickly with minimal staffing.

Anti-Podoplanin antibody

STJ180226 0.1 ml
EUR 266

Anti-Podoplanin antibody

STJ180283 0.1 ml
EUR 223

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349


MO47016 100 ul
EUR 349

Anti-Podoplanin/gp36/PDPN Antibody

A01124 100ug/vial
EUR 294

Anti-Podoplanin Rabbit Monoclonal Antibody

M01124-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-Podoplanin Rabbit Monoclonal Antibody

M01124-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human.

Anti-Podoplanin/gp36/PDPN Antibody

PA1411 100ug/vial
EUR 294

Anti-Podoplanin/gp36/PDPN Antibody

PA1674 100ug/vial
EUR 294

Anti-Podoplanin/gp36/PDPN Antibody

PA1675 100ug/vial
EUR 294

Anti-D2-40 Podoplanin antibody

STJ16100360 1 mL
EUR 1235

Anti-D2-40/Podoplanin antibody

STJ190048 200 µl
EUR 197
Description: Unconjugated Mouse monoclonal to D2-40/Podoplanin (7D1)

Mouse Podoplanin (PDPN) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Podoplanin ELISA kit

E03P0082-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Podoplanin ELISA kit

E03P0082-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Podoplanin ELISA kit

E03P0082-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anti-Human Podoplanin monoclonal antibody, clone JID761

CABT-L2919-100uL500uL 100 uL, 500 uL
EUR 502

Podoplanin antibody

70R-50819 100 ul
EUR 244
Description: Purified Polyclonal Podoplanin antibody

Podoplanin antibody

70R-PR007 100 ug
EUR 422
Description: Affinity purified Rabbit polyclonal Podoplanin antibody

Podoplanin antibody

70R-6816 50 ug
EUR 467
Description: Rabbit polyclonal Podoplanin antibody raised against the N terminal of PDPN

Podoplanin antibody

70R-6817 50 ug
EUR 467
Description: Rabbit polyclonal Podoplanin antibody raised against the middle region of PDPN

Podoplanin Antibody

49474-100ul 100ul
EUR 333

Podoplanin Antibody

49474-50ul 50ul
EUR 239

Podoplanin antibody

10R-7662 100 ug
EUR 629
Description: Mouse monoclonal Podoplanin antibody

Podoplanin antibody

10R-7663 100 ug
EUR 629
Description: Hamster monoclonal Podoplanin antibody

Podoplanin antibody

10R-7664 100 ug
EUR 629
Description: Mouse monoclonal Podoplanin antibody

Podoplanin antibody

10R-P133a 100 ug
EUR 507
Description: Mouse monoclonal Podoplanin antibody

Podoplanin antibody

10R-P155a 100 ug
EUR 543
Description: Hamster monoclonal Podoplanin antibody

Podoplanin antibody

70R-13952 100 ug
EUR 305
Description: Affinity purified Rabbit polyclonal Podoplanin antibody

Podoplanin antibody

70R-11540 100 ug
EUR 527
Description: Rabbit polyclonal Podoplanin antibody

Podoplanin Antibody

DF12456 200ul
EUR 304
Description: Podoplanin antibody detects endogenous levels of Podoplanin.

Podoplanin Antibody

P1051-01m 0.1m
EUR 209

Podoplanin Antibody

P1051-1ml 1ml
EUR 941

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Mouse Podoplanin (PDPN) ELISA Kit

abx571749-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse Podoplanin, Pdpn ELISA KIT

ELI-06723m 96 Tests
EUR 865

Mouse Podoplanin (PDPN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Podoplanin (PDPN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Podoplanin (PDPN) ELISA Kit

EUR 527
  • Should the Mouse Podoplanin (PDPN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Podoplanin (PDPN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Podoplanin (PDPN) ELISA Kit

EUR 688
  • Should the Mouse Podoplanin (PDPN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Podoplanin (PDPN) in samples from tissue homogenates, cell lysates or other biological fluids.

Recombinant Mouse Podoplanin (C-Fc)

CU73-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Podoplanin (C-Fc)

CU73-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Podoplanin (C-Fc)

CU73-500ug 500ug
EUR 1166
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Podoplanin (C-Fc)

CU73-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Podoplanin (PDPN) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDPN (Gly23~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Podoplanin (PDPN)

Mouse Podoplanin (PDPN) ELISA Kit

SEC719Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podoplanin (PDPN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podoplanin (PDPN) in tissue homogenates, cell lysates and other biological fluids.

Mouse Podoplanin (PDPN) ELISA Kit

SEC719Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podoplanin (PDPN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podoplanin (PDPN) in tissue homogenates, cell lysates and other biological fluids.

Mouse Podoplanin (PDPN) ELISA Kit

SEC719Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podoplanin (PDPN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podoplanin (PDPN) in tissue homogenates, cell lysates and other biological fluids.

Mouse Podoplanin (PDPN) ELISA Kit

SEC719Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podoplanin (PDPN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podoplanin (PDPN) in tissue homogenates, cell lysates and other biological fluids.

Mouse Podoplanin (PDPN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Podoplanin elisa. Alternative names of the recognized antigen: GP40
  • GP36
  • Gp38
  • HT1A-1
  • OTS8
  • PA2.26
  • T1A
  • T1A-2
  • Aggrus
  • Glycoprotein 36
  • PA2.26 antigen
  • T1-alpha
  • Lung Type I Cell Membrane Associated Glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Podoplanin (PDPN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Podoplanin (PDPN) ELISA Kit

RD-PDPN-Mu-48Tests 48 Tests
EUR 533

Mouse Podoplanin (PDPN) ELISA Kit

RD-PDPN-Mu-96Tests 96 Tests
EUR 740

Mouse Podoplanin (PDPN) ELISA Kit

RDR-PDPN-Mu-48Tests 48 Tests
EUR 557

Mouse Podoplanin (PDPN) ELISA Kit

RDR-PDPN-Mu-96Tests 96 Tests
EUR 774

Mouse Podoplanin(PDPN)ELISA kit

QY-E21215 96T
EUR 361

Podoplanin Conjugated Antibody

C49474 100ul
EUR 397

Podoplanin Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Podoplanin (PDPN) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Podoplanin (PDPN) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Podoplanin (PDPN) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Podoplanin (PDPN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Podoplanin (PDPN) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Podoplanin (PDPN) Antibody

  • EUR 1414.00
  • EUR 662.00
  • 1 mg
  • 200 ug
  • Please enquire.

Podoplanin (PDPN) Protein

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Podoplanin (PDPN) Antibody

abx433110-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Podoplanin (PDPN) Antibody

abx236598-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Podoplanin (PDPN) Antibody

abx236599-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Podoplanin (PDPN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Podoplanin Blocking Peptide

33R-2420 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDPN antibody, catalog no. 70R-6816

Podoplanin Blocking Peptide

33R-9441 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDPN antibody, catalog no. 70R-6817

Recombinant Human Podoplanin

7-05839 5µg Ask for price

Recombinant Human Podoplanin

7-05840 25µg Ask for price

Recombinant Human Podoplanin

7-05841 1mg Ask for price

Podoplanin Blocking Peptide

DF12456-BP 1mg
EUR 195

Recombinant Podoplanin (PDPN)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86YL7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Podoplanin expressed in: E.coli

Recombinant Podoplanin (PDPN)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62011
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Podoplanin expressed in: E.coli

Syrian Hamster Anti-Mouse Podoplanin (gp38) Monoclonal antibody, clone 8.1.1

CABT-L4294-1mg 1 mg
EUR 897

Syrian Hamster Anti-Mouse Podoplanin (gp38) Monoclonal antibody, clone 8.1.1

CABT-L4294-5mg 5 mg
EUR 2405

ELISA kit for Mouse PDPN (Podoplanin)

ELK7080 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Podoplanin (PDPN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Podoplanin (PDPN
  • Show more
Description: A sandwich ELISA kit for detection of Podoplanin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse PDPN (Podoplanin)

E-EL-M2409 1 plate of 96 wells
EUR 534
  • Gentaur's PDPN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PDPN. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PDPN (Podoplanin) in samples from Serum, Plasma, Cell supernatant

Podoplanin (PDPN) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDPN (Gly23~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Podoplanin (PDPN). This antibody is labeled with APC.

Podoplanin (PDPN) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDPN (Gly23~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Podoplanin (PDPN). This antibody is labeled with Biotin.

Podoplanin (PDPN) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDPN (Gly23~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Podoplanin (PDPN). This antibody is labeled with Cy3.

Podoplanin (PDPN) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDPN (Gly23~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Podoplanin (PDPN). This antibody is labeled with FITC.

Podoplanin (PDPN) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDPN (Gly23~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Podoplanin (PDPN). This antibody is labeled with HRP.

Podoplanin (PDPN) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDPN (Gly23~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Podoplanin (PDPN). This antibody is labeled with PE.

ELISA kit for Mouse Podoplanin (PDPN)

KTE70775-48T 48T
EUR 332
  • Podoplanin is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a d
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Podoplanin (PDPN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Podoplanin (PDPN)

KTE70775-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Podoplanin is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a d
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Podoplanin (PDPN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Podoplanin (PDPN)

KTE70775-96T 96T
EUR 539
  • Podoplanin is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a d
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Podoplanin (PDPN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Anti-Podoplanin Antibody Clone PDPN/1433, Unconjugated-100ug

10630-MSM1-P1 100ug
EUR 428

Rat Podoplanin (PDPN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Cow Podoplanin (PDPN) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Podoplanin ELISA kit

E02P0082-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Podoplanin ELISA kit

E02P0082-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Podoplanin ELISA kit

E02P0082-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Podoplanin ELISA kit

E04P0082-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Podoplanin ELISA kit

E04P0082-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Podoplanin ELISA kit

E04P0082-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Podoplanin ELISA kit

E01P0082-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Podoplanin ELISA kit

E01P0082-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Podoplanin ELISA kit

E01P0082-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Podoplanin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


“Scentsor”: A Complete-Cell Yeast Biosensor with an Olfactory Reporter for Low-Value and Gear-Free Detection of Prescribed drugs

Transportable and cheap analytical instruments are required to watch pharmaceutical high quality in expertise restricted settings together with low- and middle-income nations (LMICs). Complete cell yeast biosensors have the potential to assist meet this want.

Nevertheless, a lot of the read-outs for yeast biosensors require costly gear or reagents. To beat this problem, we’ve designed a yeast biosensor that produces a singular scent as a readout. This inducible scent biosensor, or “scentsor,” doesn’t require the consumer to manage extra reagents for reporter growth and makes use of solely the consumer’s nostril to be “learn.” On this manuscript, we describe a scentsor that’s conscious of the hormone estradiol (E2). The perfect estimate threshold (BET) for E2 detection with a panel of human volunteers (n = 49) is 39 nM E2 (15 nM when “non-smellers” are excluded).

This focus of E2 is delicate sufficient to detect ranges of E2 that might be present in dosage varieties. This manuscript supplies proof that scent has potential to be used in moveable yeast biosensors as a learn out, significantly to be used technology-limited environments.

Private Protecting Gear within the Paediatric Emergency Division through the COVID-19 pandemic. Estimating necessities based mostly on workers numbers and affected person shows


Targets: To estimate the Private Protecting Gear (PPE) required in a Paediatric Emergency Division through the COVID-19 pandemic evaluating the use per affected person to make use of per affected person zone, based mostly on the NSW Scientific Excellence Fee (CEC) pointers in place on the time of the examine.


Strategies: A retrospective case observe assessment of all sufferers and workers current within the emergency division of The Youngsters’s Hospital at Westmead, Sydney, Australia within the 24hour interval of Sunday 5th April 2020. The first consequence of PPE estimates was generated from figuring out the variety of affected person contacts and aerosol producing procedures (AGPs) carried out per affected person in addition to the variety of workers on shift.


Outcomes: 100 sufferers attended the ED (50% of ordinary) and all had been included within the examine. For a low danger group surroundings allocating PPE per affected person contact required 48 face shields, 382 surgical masks, 48 N95 masks and 430 robes for the day, growing to 430 face shields, 331 surgical masks,


430 N95 masks and 761 robes in a high-risk group surroundings. Allocating PPE utilizing zoning reduces the requirement to 48 face shields, 192 surgical masks, 48 N95 masks and 204 robes, growing to 196 face shields, 96 surgical masks, 196 N95 masks and 292 robes per day in a high-risk group surroundings.


Conclusion: This examine has demonstrated the appreciable requirement for PPE in a Paediatric ED, which varies in keeping with presentation sort and the background prevalence of COVID-19 locally. This text is protected by copyright. All rights reserved.


Utility of the remaining vaccine vial monitor life calculation to area temperature monitoring information to enhance visibility into chilly chain gear efficiency

Vaccine Vial Displays (VVM) are used to estimate if a vaccine has been uncovered to extreme sizzling temperatures. This endpoint measurement is beneficial in figuring out if a vaccine is secure to be administered to a affected person, but it surely doesn’t pinpoint the place within the chilly chain a vaccine was uncovered to extreme warmth. With the enlargement and technological development of chilly chain gear temperature monitoring, it’s now attainable to remotely estimate VVM standing as a vaccine strikes by means of the chilly chain.
Within the current examine, we study the appliance of the mathematical ideas backing VVMs on actual, steady, temperature monitoring information in Africa. Outcomes counsel that publicity to quick bursts of high temperature or lengthy energy outages should still permit for secure distribution of affected vaccines. The remaining VVM life calculation might enhance managerial visibility into chilly chain gear efficiency permitting for higher data-driven planning and upkeep selections.


GRO / KC (CXCL1) Protein
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
GRO1/KC Mouse Recombinant Protein (CXCL1)
PROTP12850-1 Regular: 20ug
EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.
Recombinant Mouse (E.Coli) GRO/KC (CXCL1)
RP-1037 5 ug
EUR 164
GRO/KC (CXCL1), Rat Recombinant
EUR 370
GRO/KC (CXCL1), Rat Recombinant
EUR 175
Recombinant Murine KC (CXCL1) Protein
PROTP12850-2 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.
GRO, KC, CXCL1, rRtGRO, rat
RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag
PROTP12850 Regular: 20ug
EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)
RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Recombinant Rat GRO/KC (CXCL1) Protein
PROTP14095-1 25ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.
RK00196 96 Tests
EUR 521
KC protein (Mouse)
30R-AK001 20 ug
EUR 273
Description: Purified recombinant Mouse KC protein
Anti-CXCL1 antibody
STJ72026 100 µg
EUR 260
Anti-CXCL1 antibody
STJ28366 100 µl
EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Rabbit Anti Mouse Cxcl1 Polyclonal Antibody
CPBT-65100RM 0.1 mg
EUR 881
KC antibody
70R-KR006 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody
KC Antibody
EUR 376
KC Antibody
EUR 392
KC Antibody
EUR 146
KC antibody
20R-1786 100 ug
EUR 651
Description: Rabbit polyclonal KC antibody
KC antibody
70R-12297 100 ug
EUR 527
Description: Rabbit polyclonal KC antibody
KC antibody
70R-12298 100 ug
EUR 492
Description: Rabbit polyclonal KC antibody
anti-7-ketocholesterol (7-KC) (35A)
LF-MA90006 20 ug
EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)
anti-7-ketocholesterol (7-KC) (35A)
LF-MA90007 100 ug
EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)
Anti-GRO alpha/Cxcl1 Antibody
A00533 100ug/vial
EUR 294
Anti-GRO alpha/CXCL1 Antibody
PA1760 100ug/vial
EUR 294
Polyclonal KC Antibody
APR16969G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:
KC 12291 hydrochloride
B7332-10 10 mg
EUR 373
KC 12291 hydrochloride
B7332-50 50 mg
EUR 1363
KC Blocking Peptide
33R-11041 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298
KC Blocking Peptide
EUR 153
GRO-alpha/CXCL1, Mouse
HY-P7188 50ug
EUR 533
55R-1741 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory
Mouse CXCL1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
E21-597 10ug
EUR 343
EF012822 96 Tests
EUR 689
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXCL1 Antibody
43679-100ul 100ul
EUR 252
CXCL1 protein
30R-3156 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein
CXCL1 Antibody
33054-100ul 100ul
EUR 252
CXCL1 antibody
70R-14297 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-10502 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-15473 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-16681 50 ul
EUR 435
Description: Rabbit polyclonal CXCL1 antibody
CXCL1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CXCL1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
Cxcl1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
CXCL1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
PVT10178 2 ug
EUR 301
Rabbit Anti Rat Cxcl1 Polyclonal Antibody
CPBT-65101RR 0.1 mg
EUR 881
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
KiloGreen 2X qPCR MasterMix-iCycler
MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140
GRO/KC, murine recombinant
EUR 773
GRO/KC, murine recombinant
EUR 3856
GRO/KC, murine recombinant
EUR 256
ELISA kit for Mouse CXCL1
EK5299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse CXCL1 PicoKine ELISA Kit
EK0723 96 wells
EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.
CXCL1 protein (Mouse) (His tag)
80R-3368 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)
CXCL1 protein (Mouse) (His tag)
80R-3439 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)
Mouse CXCL1 Detection Assay Kit
6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit
Mouse CXCL1/GROα ELISA kit
LF-EK50473 1×96T
EUR 648
Cxcl1 ORF Vector (Mouse) (pORF)
ORF042286 1.0 ug DNA
EUR 95
CXCL1 ELISA Kit (Mouse) (OKAN04583)
OKAN04583 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL
CXCL1 ELISA Kit (Mouse) (OKBB00312)
OKBB00312 96 Tests
EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml
CXCL1 ELISA Kit (Mouse) (OKCD05712)
OKCD05712 96 Wells
EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL
KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)
OKAG00090 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL
CXCL1 Conjugated Antibody
C33054 100ul
EUR 397
CXCL1 cloning plasmid
CSB-CL006239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.
CXCL1 Blocking Peptide
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Cxcl1 Polyclonal Antibody
A51950 100 µg
EUR 570.55
Description: fast delivery possible
CXCL1 Polyclonal Antibody
A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research
CXCL1 Blocking Peptide
33R-7741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502
CXCL1 antibody (HRP)
60R-2236 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)
CXCL1 antibody (FITC)
60R-2237 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)
CXCL1 antibody (biotin)
60R-2238 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)
Recombinant Human CXCL1
P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1
PVT13291 2 ug
EUR 391
GRO-alpha/CXCL1 (CHO-expressed), Mouse
HY-P7186 50ug
EUR 337
Mouse CXCL1 AssayLite Antibody (FITC Conjugate)
70027-05141 150 ug
EUR 428
Cxcl1 sgRNA CRISPR Lentivector set (Mouse)
K4368201 3 x 1.0 ug
EUR 339
Mouse Growth-regulated alpha protein (Cxcl1)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli
Mouse CXCL1/GROα ELISA kit (4X96T)
LF-EK50474 4×96T
EUR 2201

Leave a Reply

Your email address will not be published. Required fields are marked *